This repository contains a python script required for titering for GFP-CellTag Virus. For a detailed explanation, please refer to the paper: Guo et. al., CellTag ...

Lentiviruses have the unique ability amongst retroviruses of being able to infect non-cycling cells. Vectors derived from lentiviruses have provided a huge advancement in technology and seemingly ...

Gene knockdown was performed by lentivirus short hairpin RNAs (sh-RNAs) which were cloned into pLKO.1 (GV248) lentiviral vectors. The sh-PGC-1β targeting sequence was GGAGGAGGAAGAAGAAGAATT, while ...